Journal: International Journal of Molecular Sciences

Article Title: Downregulation of Protease Cathepsin D and Upregulation of Pathologic α-Synuclein Mediate Paucity of DNAJC6-Induced Degeneration of Dopaminergic Neurons

doi: 10.3390/ijms25126711

Figure Lengend Snippet: Paucity of DNAJC6 decreases LysoTracker staining intensity of lysosomes and immunofluorescence staining intensity of LAMP2-positive lysosomes in dopaminergic neurons. ( A ) Live cell imaging of lysosomes was conducted by treating differentiated SH-SY5Y dopaminergic neurons with 100 nM LysoTracker Yellow HCK-123, which stains acidic compartments and visualizes lysosomes, for 1 h. A three-day transfection of shRNA1 or shRNA2 targeting DNAJC6 significantly decreased the fluorescence intensity of LysoTracker Yellow staining in dopaminergic neurons. SC shRNA failed to affect lysosomal staining of LysoTracker Yellow HCK-123. Scale bar is 50 μm. ( B ) Immunofluorescence staining of lysosomal marker protein LAMP2 was performed to visualize lysosomes of dopaminergic neurons. Following a 3-day transfection of shRNAs targeting DNAJC6, the fluorescence intensity of LAMP2-positive puncta was significantly decreased in dopaminergic neurons. SC shRNA did not affect the immunofluorescence staining intensity of LAMP2. Scale bar is 60 μm. Each bar shows the mean ± S.E. value of 6 experiments. ** p < 0.01 compared with control dopaminergic neurons.

Article Snippet: The pRS shRNA vector containing shRNA targeting human α-synuclein (shRNA1: 5′TCAGAAGTTGTTAGTGATTTGCTATCATA3′; shRNA2: 5′GGTATCAAGACTACGAACCTGAAGCCTAA3′) was purchased from OriGene (Rockville, MD, USA).

Techniques: Staining, Immunofluorescence, Live Cell Imaging, Transfection, Fluorescence, shRNA, Marker, Control

Journal: bioRxiv

Article Title: Discovery of a molecular glue that enhances UPR mt to restore proteostasis via TRKA-GRB2-EVI1-CRLS1 axis

doi: 10.1101/2021.02.17.431525

Figure Lengend Snippet: (A) The BZ555 strain was pretreated with 6-OHDA (30 mM) for 1 h then transferred to the plates with 5-Fluorouridine (0.04 mg/mL) and indicated concentrations of Rg3 or L-DOPA (10 µM) for 72 h. The fluorescence intensity of dopaminergic neurons was measured. (B) The eggs of NL5901 strain were treated with indicated concentrations of Rg3 or L-DOPA (10 µM). After growing to the L4 stage, the nematodes were treated with 5-Fluorouridine (0.04 mg/mL) for 12 days. The fluorescence intensity of α-synuclein protein in nematodes was measured. (C) The N2 strain was pretreated 6-OHDA (30 mM) for 1 h then transferred to the plates with Rg3 (90 µM) for 36h. The cardiolipin content was measured by NAO (10 μM) fluorescence signaling. (D-E) The BZ555 strain was cultured for three generations on culture plates with bacteria containing the indicated RNAi in the presence of Rg3 (90 µM). (D) Then the fluorescence intensity of dopaminergic neurons was measured. (E) The BZ555 strain was pretreated with 6-OHDA (30 mM) for 1 h then transferred to the plates with Rg3 (90 µM), 5-Fluorouridine (0.04 mg/mL) and cardiolipin (100 µg/ml) as indicated for 72 h. (F) The SJ4100 strain was treated with 6-OHDA (30 mM), 5-Fluorouridine (0.04 mg/mL) and Rg3 (90 µM) as indicated for different durations. The fluorescence representing UPR mt was measured. (G) The SJ4100 strain was treated with Rg3 (90 µM) and 6-OHDA (30 mM) as indicated for 12 h, the fluorescence representing UPR mt was measured. (H) The BZ555 strain fed with hsp-6 RNAi was pretreated with 6-OHDA (30 mM) for 1 h then transferred to the plates with 5-Fluorouridine (0.04 mg/mL) and Rg3 (90 µM) as indicated for 72 h. (I) The BZ555 strain fed with hsp-6 RNAi was pretreated with 6-OHDA (30 mM) for 1 h then transferred to the plates with 5-Fluorouridine (0.04 mg/mL), Rg3 (90 µM) and cardiolipin (100 µg/ml) as indicated for 72 h. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. indicated control (n=5-12).

Article Snippet: HEK293 cells were transfected with human alpha-synuclein overexpressioin plasmid (Cat: HG12093-ANG, Sinobiological, Beijing, China) using Lipo3000.

Techniques: Fluorescence, Cell Culture

Journal: bioRxiv

Article Title: Discovery of a molecular glue that enhances UPR mt to restore proteostasis via TRKA-GRB2-EVI1-CRLS1 axis

doi: 10.1101/2021.02.17.431525

Figure Lengend Snippet: (A) The BZ555 strain was pretreated with 6-OHDA (30 mM) for 1 h then transferred to the plates with 5-Fluorouridine (0.04 mg/mL) and indicated concentrations of Rg3 or L-DOPA (10 µM) for 72 h. The fluorescence intensity of dopaminergic neurons was measured. Scale bar: 40 µm. (B) The eggs of NL5901 strain were treated with indicated concentrations of Rg3 or L-DOPA (10 µM). After growing to the L4 stage, the nematodes were treated with 5-Fluorouridine (0.04 mg/mL) for 12 days. The fluorescence intensity of α-synuclein protein in nematodes was measured. Scale bar: 40 µm. (C) The N2 strain was pretreated 6-OHDA (30 mM) for 1 h then transferred to the plates with Rg3 (90 µM) for 36h. The cardiolipin content was measured by NAO (10 μM) fluorescence signaling. Scale bar: 100 µm. (D-E) The eggs of NL5901 strain were treated with indicated concentrations of Rg3 or L-DOPA (10 µM). After growing to the L4 stage, the nematodes were treated with 5-Fluorouridine (0.04 mg/mL). After 60 h, the number of nematodes was recorded every day. ** p < 0.01, *** p < 0.001, **** p < 0.0001 vs. indicated control (A-C: n=5-12; D-E: n=29-38).

Article Snippet: HEK293 cells were transfected with human alpha-synuclein overexpressioin plasmid (Cat: HG12093-ANG, Sinobiological, Beijing, China) using Lipo3000.

Techniques: Fluorescence

Journal: bioRxiv

Article Title: Discovery of a molecular glue that enhances UPR mt to restore proteostasis via TRKA-GRB2-EVI1-CRLS1 axis

doi: 10.1101/2021.02.17.431525

Figure Lengend Snippet: (A) HEK293 cells were transfected with GFP-tagged α-synuclein plasmid, and then treated with Rg3 (5 μM) or L-DOPA (10 μM) for 48 h. The amount of α-synuclein protein level was measured by green fluorescence signals. Scale bar: 100 µm. (B-C) SH-SY5Y cells were treated with Rg3 (5 μM) and 6-OHDA (60 μM) for 24 h: (B) Fluorescence intensity of cells was measured by NAO (5 μM) fluorescence signaling. Scale bar: 100 µm. (C) Total proteins were extracted and subjected to western blot with indicated antibodies. All experiments were repeated at least three times, * p < 0.05, ** p < 0.01 vs. indicated control.

Article Snippet: HEK293 cells were transfected with human alpha-synuclein overexpressioin plasmid (Cat: HG12093-ANG, Sinobiological, Beijing, China) using Lipo3000.

Techniques: Transfection, Plasmid Preparation, Fluorescence, Western Blot